Información

¿Cómo se debe expresar el intervalo entre diluciones seriadas?


El intervalo entre diluciones simples es un valor constante que se agrega a la dilución anterior para obtener la siguiente. ¿Cómo se debe mencionar un factor para las diluciones en serie? Como no existe una diferencia común entre las sucesivas diluciones en serie, más bien una proporción común.


¿Cómo se debe expresar el intervalo entre diluciones seriadas? - biología

Una dilución simple es aquella en la que una unidad de volumen de un material líquido de interés se combina con un volumen apropiado de un líquido disolvente para lograr la concentración deseada. El factor de dilución es el número total de unidades de volumen en las que se disolverá su material. Luego, el material diluido debe mezclarse completamente para lograr la verdadera dilución. Por ejemplo, una dilución 1: 5 (verbalizar como dilución "1 a 5") implica combinar 1 unidad de volumen de soluto (el material a diluir) + 4 unidades de volumen del medio solvente (por lo tanto, 1 + 4 = 5 = factor de dilución) . El factor de dilución se expresa con frecuencia utilizando exponentes: 1: 5 sería 5e-1 1: 100 sería 10e-2, y así sucesivamente.

Ejemplo 1: El concentrado de jugo de naranja congelado generalmente se diluye con 4 latas adicionales de agua fría (el solvente de dilución) dando un factor de dilución de 5, es decir, el concentrado de naranja representa una unidad de volumen al que se le han agregado 4 latas más (la misma unidad de volumen). ) de agua. Entonces, el concentrado de naranja ahora se distribuye en 5 unidades de volumen. Esto se llamaría una dilución 1: 5, y el DO ahora es 1/5 de la concentración que tenía originalmente. Entonces, en una dilución simple, agregue una unidad de volumen menos de solvente que el valor del factor de dilución deseado.

Ejemplo 2: Suponga que debe preparar 400 ml de un desinfectante que requiere una dilución 1: 8 de una solución madre concentrada con agua. Divida el volumen necesario por el factor de dilución (400 ml / 8 = 50 ml) para determinar la unidad de volumen. La dilución se realiza luego como 50 ml de desinfectante concentrado + 350 ml de agua.

2. Dilución en serie

Una dilución en serie es simplemente una serie de diluciones simples que amplifican el factor de dilución rápidamente comenzando con una pequeña cantidad inicial de material (es decir, cultivo bacteriano, una sustancia química, jugo de naranja, etc.). La fuente de material de dilución (soluto) para cada paso proviene del material diluido del paso de dilución anterior. En una dilución en serie, el factor de dilución total en cualquier punto es el producto de los factores de dilución individuales en cada paso previo.

Factor de dilución final (DF) = DF 1 * DF 2 * DF 3 etc.

Ejemplo: En un ejercicio típico de microbiología, los estudiantes realizan una dilución en serie de tres pasos 1: 100 de un cultivo bacteriano (ver figura a continuación) en el proceso de cuantificar el número de bacterias viables en un cultivo (ver figura a continuación). Cada paso de este ejemplo utiliza un volumen total de 1 ml. El paso inicial combina 1 unidad de volumen de cultivo bacteriano (10 ul) con 99 unidades de volumen de caldo (990 ul) = dilución 1: 100. En el segundo paso, se combina una unidad de volumen de la dilución 1: 100 con 99 unidades de volumen de caldo, lo que da como resultado una dilución total de 1: 100x100 = 1: 10,000 dilución. Repitiendo nuevamente (el tercer paso) la dilución total sería 1: 100x10,000 = 1: 1,000,000 de dilución total. La concentración de bacterias es ahora un millón de veces menor que en la muestra original.

3. Realización de volúmenes fijos de concentraciones específicas a partir de reactivos líquidos:

Método V 1 C 1 = V 2 C 2

Muy a menudo, necesitará hacer un volumen específico de concentración conocida a partir de soluciones madre, o tal vez debido a la disponibilidad limitada de materiales líquidos (algunos productos químicos son muy costosos y solo se venden y usan en pequeñas cantidades, por ejemplo, microgramos), o para limitar la cantidad de desechos químicos. La siguiente fórmula es un método rápido para calcular tales diluciones cuando:

V = volumen, C = concentración en las unidades en las que esté trabajando.

(atributos de la solución stock) V 1 C 1 = V 2 C 2 (nuevos atributos de la solución)

Ejemplo: Suponga que tiene 3 ml de una solución stock de 100 mg / ml de ampicilina (= C 1) y desea hacer 200 ul (= V 2) de una solución que tenga 25 mg / ml (= C 2). Necesita saber qué volumen (V 1) del stock utilizar como parte del volumen total de 200 ul necesario.

V 1 = el volumen de stock con el que empezará. Este es tu desconocido.
C 1 = 100 mg / ml en la solución madre
V 2 = volumen total necesario a la nueva concentración = 200 ul = 0,2 ml
C 2 = la nueva concentración = 25 mg / ml

Por reordenamiento algebraico:

V 1 = (V 2 x C 2) / C 1

V 1 = (0,2 ml x 25 mg / ml) / 100 mg / ml

y luego de cancelar las unidades,

V 1 = 0,05 ml o 50 ul

Por lo tanto, tomaría 0.05 ml = 50 ul de solución madre y la diluiría con 150 ul de solvente para obtener los 200 ul de
Se necesita una solución de 25 mg / ml. Recuerde que la cantidad de solvente utilizada se basa en el volumen final necesario, por lo que debe restar el volumen inicial del final para calcularlo.

4. Moles y soluciones molares (unidad = M = moles / L)

A veces puede resultar más eficaz utilizar la molaridad al expresar concentraciones químicas. A Topo se define como exactamente 6.023 x 1023 átomos, o moléculas, de una sustancia (esto se llama Avagadro's número, N). La masa de un mol de un elemento es su masa atomica (g) y se anota para cada elemento de la tabla periódica. Peso molecular es la masa (g) de una sustancia basada en la suma de las masas atómicas de los elementos en la fórmula química. El peso de la fórmula se refiere a productos químicos para los que no existen moléculas discretas, por ejemplo, el NaCl en forma sólida está compuesto por iones Na + y Cl-, pero no hay moléculas verdaderas de NaCl. los fórmula peso de 1 mol de NaCl sería, por tanto, la suma de 1 masa atómica de cada ion. El peso molecular (o FW) se proporciona como parte de la información en la etiqueta de una botella de producto químico. El número de moles en una masa arbitraria de un elemento o compuesto se puede calcular como:

número de moles = peso (g) / peso atómico (o molecular) (g)

Molaridad (M) es la unidad utilizada para describir el número de moles de un elemento o compuesto en un litro (L) de solución (M = moles / L) y, por lo tanto, es una unidad de concentración. Según esta definición, una solución 1.0 M equivale a un peso molecular (g / mol) de un compuesto llevado a un volumen de 1 litro (1.0 L) con solvente (por ejemplo, agua) a una temperatura fija (los líquidos se expanden y contraen con la temperatura). y así puede cambiar la molaridad).

Ejemplo 1: Para preparar un litro de solución molar a partir de un reactivo seco

Multiplique el peso molecular (o FW) por la molaridad deseada para determinar cuántos gramos de reactivo utilizar:

Suponga que el PM de un compuesto = 194,3 g / mol

para hacer una solución 0.15 M use 194.3 g / mol * 0.15 moles / L = 29.145 g / L

Disolvería la masa especificada de reactivo en una fracción del volumen total de solvente (en STP) y luego elevaría el volumen a exactamente un litro agregando solvente adicional y mezclando bien.

Ejemplo 2: Para preparar un volumen específico de una solución molar específica a partir de un reactivo seco.

Una sustancia química tiene un FW de 180 g / mol y necesita 25 ml (0.025 L) de solución 0.15 M (M = moles / L). ¿Cuántos gramos de la sustancia química se necesitan para preparar esta solución?

# gramos / volumen deseado (L) = molaridad deseada (mol / L) * FW (g / mol)

por reordenamiento algrebraico,

# gramos = volumen deseado (L) * molaridad deseada (mol / L) * FW (g / mol) #gramos = 0.025 L * 0.15 mol / L * 180 g / mol

después de cancelar las unidades,

#grams = 0.675 gramo

Soluciones que contienen varios reactivos

Las soluciones complejas como tampones, soluciones salinas, fijadores, etc., pueden estar compuestas por múltiples reactivos químicos. En la preparación de estas soluciones, cada reactivo se trata por separado para determinar cuánto usar para hacer la solución final. Para cada uno, el volumen utilizado en los cálculos es el volumen final de solución necesario.

Más ejemplos de problemas resueltos: About.com: Química

5. Porcentaje de soluciones (% = partes por cien o gramos / 100 ml)

Muchos reactivos se mezclan como soluciones porcentuales ya sea como peso por volumen (p / v) al comenzar con reactivos secos O como volumen por volumen (v / v) al comenzar con reactivos líquidos. Cuando se preparan soluciones a partir de reactivos secos, se usa la misma masa de cualquier reactivo para obtener una concentración porcentual determinada, aunque las concentraciones molares serían diferentes.

Porcentaje en peso (p / v) = [masa de soluto (g) / volumen de solución (ml)] x 100, y,

Porcentaje de volumen (v / v) = [volumen de soluto (ml) / volumen de solución (ml)] x 100

Por ejemplo, una solución de 100 ml al 10% de cualquier reactivo seco contendría 10 g de reactivo seco en un volumen final de 100 ml. Una solución al 10% (v / v) contendría 10 ml de soluto / 100 ml de volumen de solución.

Ejemplo 1: Si desea preparar 200 ml de NaCl al 3%, necesitará 0,03 g / ml x 200 ml = 6,0 g de NaCl en 200 ml de agua.

Cuando se utilizan reactivos líquidos, el porcentaje de concentración se basa en volumen por volumen y se calcula de forma similar como% de concentración x volumen necesario = volumen de reactivo a utilizar.

Ejemplo 2: Si desea hacer 2 L de etanol al 70% a partir de etanol al 100%, debe mezclar 0,70 ml / ml x 2000 ml = 1400 ml de etanol con 600 ml de agua.

Para convertir de% de solución a molaridad, multiplique el% de solución por 10 para expresar el porcentaje de solución en gramos / L, luego divida por el peso de la fórmula.

Molaridad = (gramos de reactivo / 100 ml) * 10
xxxxxxxxxx FW

Ejemplo 1: Convertir una solución al 6.5% de una sustancia química con FW = 325.6 a molaridad,

[(6,5 g / 100 ml) * 10] / 325,6 g / mol = [65 g / L] / 325,6 g / mol = 0,1996 M

Para convertir de molaridad a solución porcentual, multiplique la molaridad por FW y divida por 10:

% de solución = molaridad * FW
xxxxxxxxxx 10

Ejemplo 2: Convierta una solución 0.0045 M de una sustancia química con FW 178.7 en una solución porcentual:

[0,0045 moles / L * 178,7 g / mol] / 10 = solución al 0,08%

6. Soluciones de stock concentradas - usando unidades & quotX & quot

Las soluciones madre de compuestos estables se mantienen de forma rutinaria en los laboratorios como soluciones más concentradas que se pueden diluir a la fuerza de trabajo cuando se usan en aplicaciones típicas. La concentración de trabajo habitual se indica como 1x. Una solución 20 veces más concentrada se indicaría como 20x y requeriría una dilución 1:20 para restaurar la concentración de trabajo típica.

Ejemplo: una solución 1x de un compuesto tiene una concentración molar de 0.05 M para su uso típico en un procedimiento de laboratorio. Un stock de 20x se prepararía a una concentración de 20 * 0,05 M = 1,0 M. Un stock de 30X sería 30 * 0,05 M = 1,5 M.

7. Normalidad (N): conversión a molaridad

Normalidad = n * M donde n = número de protones (H +) en una molécula del ácido.

Ejemplo: En la fórmula del sulfúrico concentrado (36 N H2SO4), hay dos protones, por lo que su molaridad = N / 2. Entonces, 36N H2SO4 = 36/2 = 18 M.


Intervalos de confianza

Los intervalos de confianza del 95 por ciento en las tablas tienen el siguiente significado:

Antes de inocular los tubos, la probabilidad es al menos del 95 por ciento de que el intervalo de confianza asociado con el resultado final incluya la concentración real.

Es posible construir muchos conjuntos diferentes de intervalos que satisfagan este criterio. Este manual utiliza una modificación del método de De Man (1983). De Man calculó sus límites de confianza iterativamente desde las concentraciones más pequeñas hacia arriba. Debido a que este manual enfatiza los patógenos, los intervalos se han desplazado ligeramente hacia arriba iterando desde las concentraciones más grandes hacia abajo.

Los intervalos de confianza de la hoja de cálculo y las tablas asociadas con este apéndice pueden ser diferentes. La hoja de cálculo de Excel MPN utiliza una aproximación normal al registro (MPN) para calcular sus intervalos de confianza. Esta aproximación es similar a una aproximación normal discutida en Haldane (1939). Esta aproximación es menos intensa computacionalmente, por lo que es más apropiada para una hoja de cálculo que los intervalos de confianza de De Man.


¿Cómo se debe expresar el intervalo entre diluciones seriadas? - biología

Estimamos la distribución de los intervalos seriados para 468 casos confirmados de enfermedad por coronavirus notificados en China al 8 de febrero de 2020. El intervalo medio fue de 3,96 días (IC del 95%: 3,53 a 4,39 días), DE 4,75 días (IC del 95%: 4,46 a 5,07 días) El 12,6% de los informes de casos indicaron transmisión presintomática.

Los aspectos clave de la dinámica de transmisión de la enfermedad por coronavirus (COVID-19) siguen sin estar claros (1). El intervalo de serie de COVID-19 se define como la duración de tiempo entre un caso-paciente primario (infeccioso) que tiene el inicio de los síntomas y un caso-paciente secundario (infectado) que tiene el inicio de los síntomas (2). La distribución de los intervalos de serie de COVID-19 es una entrada fundamental para determinar el número de reproducción básico (R0) y el alcance de las intervenciones necesarias para controlar una epidemia (3).

Para obtener estimaciones confiables del intervalo de serie, obtuvimos datos sobre 468 eventos de transmisión de COVID-19 informados en China continental fuera de la provincia de Hubei durante el período comprendido entre el 21 de enero y el 8 de febrero de 2020. Cada informe consta de una fecha probable de inicio de los síntomas tanto para el contactor como para el contactor. e infectado, así como las ubicaciones probables de la infección para ambos casos-pacientes. Los datos incluyen solo casos confirmados recopilados a partir de informes en línea de 18 centros provinciales para el control y la prevención de enfermedades (https://github.com/MeyersLabUTexas/COVID-19).

Figura. Distribución de intervalo de serie estimada para la enfermedad por coronavirus (COVID-19) basada en 468 eventos de transmisión notificados, China, del 21 de enero al 8 de febrero de 2020. A) Todos los eventos de infección (N = 468) notificados en 93 ciudades de.

Cincuenta y nueve de los 468 informes indican que el infectado tuvo síntomas antes que el infectado. Por tanto, es posible que se esté produciendo una transmisión presintomática. Dados estos intervalos de serie con valores negativos, los intervalos de serie de COVID-19 parecen parecerse a una distribución normal más que las distribuciones gamma o Weibull comúnmente asumidas (4,5), que se limitan a valores positivos (Apéndice). Estimamos un intervalo de serie medio para COVID-19 de 3,96 (IC del 95%: 3,53 a 4,39) días, con una DE de 4,75 (IC del 95%: 4,46 a 5,07) días, que es considerablemente más bajo que los intervalos de serie medios informados de 8,4 días para Síndrome respiratorio agudo severo (5) a 14,6 días (6) para el síndrome respiratorio de Oriente Medio. El intervalo serial medio es levemente pero no significativamente más largo cuando se importa el caso índice (4.06 [95% CI 3.55–4.57] días) versus localmente infectado (3.66 [95% CI 2.84–4.47] días), pero un poco más corto cuando el la transmisión ocurre dentro del hogar (4.03 [95% CI 3.12–4.94] días) versus fuera del hogar (4.56 [95% CI 3.85–5.27] días) (Figura). Combinando estos hallazgos con estimaciones publicadas para la tasa de crecimiento exponencial temprano COVID-19 en Wuhan (7), estimamos una R0 de 1,32 (IC del 95%: 1,16-1,48) (5), que es menor que las estimaciones publicadas que suponen un intervalo de serie medio superior a 7 días (7,8).

Estas estimaciones reflejan las fechas de inicio de los síntomas informadas para 752 casos-pacientes de 93 ciudades de China, que tienen edades comprendidas entre 1 y 90 años (media de 45,2 años, DE 17,21 años). Los análisis recientes de parejas infectadas-infectadas por COVID-19 de varios países han indicado intervalos seriales promedio de 4.0 días (95% CI 3.1-4.9 días n = 28 datos no publicados, H. Nishiura et al., Datos no publicados, https: //doi.org/10.1101/2020.02.03.20019497), 4,4 días (IC del 95%: 2,9–6,7 días, n = 21 S. Zhao et al., datos no publicados, https://doi.org/10.1101/2020.02. 21,20026559] y 7,5 días (IC del 95%: 5,3-19, n = 6 8). Mientras que ninguno de estos estudios reporta intervalos seriales negativos en los que el infectado tuvo síntomas antes que el contactor, el 12,6% de los intervalos seriados en nuestra muestra fueron negativos.

Observamos 4 posibles fuentes de sesgo. En primer lugar, los datos están restringidos a informes en línea de casos confirmados y, por lo tanto, podrían estar sesgados hacia casos más graves en áreas con una infraestructura de salud pública y atención médica de alto funcionamiento. El rápido aislamiento de estos casos-pacientes podría haber evitado intervalos seriales más largos, lo que podría haber desplazado nuestra estimación a la baja en comparación con los intervalos seriales que podrían observarse en una epidemia incontrolada. En segundo lugar, la distribución de los intervalos en serie varía a lo largo de una epidemia, el tiempo entre casos sucesivos se contrae alrededor del pico epidémico (9). Es probable que una persona susceptible se infecte más rápidamente si está rodeada por 2 personas infectadas en lugar de 1. Debido a que nuestras estimaciones se basan principalmente en eventos de transmisión informados durante las primeras etapas de los brotes, no tomamos en cuenta explícitamente dicha compresión e interpretamos el estimaciones como intervalos de serie básicos al comienzo de una epidemia. Sin embargo, si algunas de las infecciones reportadas ocurrieron en medio de grupos crecientes de casos, entonces nuestras estimaciones podrían reflejar intervalos seriales efectivos (comprimidos) que se esperarían durante un período de crecimiento epidémico. En tercer lugar, la identidad de cada contactor y el momento de aparición de los síntomas se basaron presumiblemente en el recuerdo individual de eventos pasados. Si el tiempo o el trauma obstaculizan la precisión del recuerdo, es más probable que los casos-pacientes atribuyan la infección a encuentros recientes (intervalos de serie cortos) que a encuentros pasados ​​(intervalos de serie más largos). Por el contrario, los intervalos en serie informados podrían estar sesgados al alza por retrasos relacionados con los viajes en la transmisión de pacientes de casos primarios que se infectaron en Wuhan u otra ciudad antes de regresar a casa. Si su período infeccioso comenzó durante el viaje, es poco probable que observemos eventos de transmisión temprana con intervalos de serie más cortos. El intervalo de serie medio es ligeramente más alto para los 218 de 301 infectores únicos reportados como casos importados.

Dada la heterogeneidad en el tipo y la confiabilidad de estas fuentes, advertimos que nuestros hallazgos deben interpretarse como hipótesis de trabajo con respecto a la infecciosidad de COVID-19, que requieren una mayor validación. Las posibles implicaciones para el control de COVID-19 son mixtas. Aunque nuestras estimaciones más bajas para R0 sugieren una contención más fácil, la gran cantidad de eventos de transmisión asintomática reportados es preocupante.

El Dr. Du es investigador postdoctoral en el Departamento de Biología Integrativa de la Universidad de Texas en Austin. Desarrolla modelos matemáticos para dilucidar la dinámica de transmisión, vigilancia y control de enfermedades infecciosas.


Introducción

El 31 de diciembre de 2019, la ciudad de Wuhan (provincia de Hubei, China) informó de un brote de neumonía atípica causada por un nuevo coronavirus, posteriormente denominado SARS-CoV-2 [1]. Las características virales y epidemiológicas de los brotes de COVID-19, como las transmisiones asintomáticas [2, 3] y los individuos no diagnosticados [4], aceleraron la propagación de la enfermedad, lo que resultó en una pandemia mundial. En respuesta a esta amenaza, varios países adoptaron medidas de control drásticas y sin precedentes, como el bloqueo nacional y regional en el que las personas diagnosticadas o rastreadas fueron confinadas en aislamiento o cuarentena [5]. Al mismo tiempo, los investigadores comenzaron a estimar cantidades epidemiológicas clave como el período de incubación, el intervalo de la serie, el tiempo de generación y el número de reproducción (ver, por ejemplo, [3, 6-11]). Es importante señalar que la mayoría de estos determinantes epidemiológicos se infirieron en situaciones para las que existían diferentes estrategias de intervención, posiblemente afectando las estimaciones resultantes. Más precisamente, las medidas de control como la cuarentena o el aislamiento de infecciosos intervienen en la reducción de los contactos sociales de dichos individuos y, en consecuencia, en la disminución de su probabilidad de transmisión tras el diagnóstico. Estas intervenciones provocan un retraso del pico epidémico [12] y una disminución del número de reproducción efectiva [13]. Por tanto, es razonable pensar que otras características de la epidemia también se ven afectadas por las intervenciones de salud pública.

Una cantidad clave en el modelado de epidemias es el tiempo de generación o el intervalo de generación, es decir, la diferencia de tiempo entre los tiempos de infección de un par infectado-infectado [14]. En particular, el tiempo de generación se puede utilizar para calcular los números de reproducción básicos y efectivos mediante la ecuación de Lotka-Euler [15]. A menudo, el tiempo de generación se aproxima por el intervalo de serie [16], es decir, la diferencia de tiempo entre el inicio de los síntomas de un par infectado-infectado y, al hacerlo, las estimaciones del número de reproducción básico para la epidemia de COVID-19 han calculado [10, 11]. Britton y Scalia Tomba [17] demostraron que reemplazar el tiempo de generación con el intervalo de serie podría conducir a una subestimación del número de reproducción (básico). De hecho, si bien tienen la misma media, la varianza de la primera es mayor que la de la última cantidad. Además, Park et al. discuten que si los individuos asintomáticos y sintomáticos tienen diferentes distribuciones de tiempo de generación, la estimación del número de reproducción está sesgada si se realiza utilizando solo datos para la población sintomática [18]. Las intervenciones no farmacéuticas, como el aislamiento, que disminuyen las interacciones sociales de los individuos diagnosticados, afectan la distribución del tiempo de generación realizada de solo los individuos diagnosticados, lo que probablemente cause el sesgo mencionado anteriormente. Además, Park et al. mostró cómo se puede utilizar el intervalo de serie para estimar el número de reproducción básico [19]. Sin embargo, en su análisis, no consideraron el efecto de las medidas de control sobre los intervalos de generación y serie realizados. Recientemente, Ali et al. investigó la relación entre el intervalo de serie y las intervenciones no farmacéuticas, informando una modificación de las distribuciones de intervalo de serie como una función de las medidas de control en los datos chinos [20]. En particular, mostraron que el intervalo serial medio disminuye cuando las medidas de control son más estrictas. Del mismo modo, Sun et al. informaron de una contracción de los intervalos de serie y generacional cuando se implementaron diferentes medidas de intervención [21]. Sin embargo, las cantidades de los mismos podrían contraerse de manera diferente, dando como resultado una diferencia entre sus valores medios. De hecho, la relación entre la serie y el intervalo generacional aún no se ha explorado en el marco de las medidas de control.

En este trabajo destacamos tres características de la dinámica pandémica de COVID-19 que afectan la media y la varianza de los intervalos seriales y generacionales. Primero, la eficacia de las medidas de control, determinada por el momento de inicio de la cuarentena y el aislamiento en relación con la exposición y por la magnitud de la reducción de la tasa de contacto. En segundo lugar, la presencia de una población no diagnosticada, de la cual los individuos escapan al diagnóstico, de manera que no se ve afectada por las intervenciones consideradas. En tercer lugar, la relación entre la infecciosidad, el período de incubación y el momento en que tienen lugar las intervenciones durante el período infeccioso. Después de presentar una descripción teórica del efecto de las medidas de control sobre los intervalos de generación y serie esperados, establecimos un estudio de simulación para obtener información sobre los determinantes que afectan los intervalos de generación y serie realizados en presencia de medidas de control.


Las diluciones en serie implican diluir una solución madre o estándar varias veces seguidas. Normalmente, el factor de dilución permanece constante para cada dilución, lo que resulta en una disminución exponencial de la concentración. Por ejemplo, una dilución en serie diez veces mayor podría dar como resultado las siguientes concentraciones: 1 M, 0,1 M, 0,01 M, 0,001 M, etc. Como se evidencia en este ejemplo, la concentración se reduce en un factor de diez en cada paso. Las diluciones en serie se utilizan para crear con precisión soluciones extremadamente diluidas, así como soluciones para experimentos que requieren una curva de concentración con una escala exponencial o logarítmica. Las diluciones en serie se utilizan ampliamente en las ciencias experimentales, incluidas la bioquímica, la farmacología, la microbiología y la física.

Solución de problemas de dilución en química de soluciones CLEAR & amp SIMPLE & # 8211 YouTubeEste video muestra cómo resolver dos problemas de dilución, utilizando la fórmula de dilución estándar, M1V1 = M2V2.

Boundless examina y selecciona contenido de alta calidad con licencia abierta de Internet. Este recurso en particular utilizó las siguientes fuentes:


MATERIALES Y MÉTODOS

Simulaciones numéricas.

Para examinar el efecto teórico de la dilución sobre la composición del inóculo de la comunidad, se realizó una serie de simulaciones numéricas (codificadas en MATLAB). Las comunidades se construyeron asignando a cada uno de 10 6 individuos una identificación de especie aleatoria basada en una distribución normal de números enteros de 1 a 1,000. La media de esta distribución se fijó en 500 y la varianza (var) se ajustó para crear comunidades de diferente uniformidad inicial (Fig. & # X200B (Fig.1A). 1 A). Los niveles de var utilizados fueron 100, 250, 1,000 y 20,000, y también se generó una comunidad inicial perfectamente pareja (1,000 tipos, cada uno con 1,000 individuos). La dilución de cada una de estas cinco comunidades iniciales se simuló seleccionando al azar a 1/10 de los individuos de la matriz que representa la comunidad no diluida. La identificación de especie de cada individuo en este subconjunto se copió en una segunda matriz, que sirvió como comunidad inicial para la siguiente dilución de la serie (diluciones extendidas hasta 10 & # x022125). Para cada comunidad, en cada nivel de dilución, se calcularon la riqueza, la uniformidad y la diversidad. Riqueza (S) se tomó como el número de tipos de organismos (especies) en la comunidad. La diversidad se expresó como el índice de Shannon-Wiener (H& # x02032) como sigue I mínimos: H& # x02032 = & # x003a3 pagI en pagI, dónde I indica cada especie o categoría y pagI es la proporción 1 de individuos de cada especie (37). Uniformidadmi) se calculó como mi = H& # x02032 /H& # x02032max, dónde H& # x02032max = En S (31).

(A) Distribución de individuos entre 1000 tipos en las comunidades iniciales utilizadas en las simulaciones. Tenga en cuenta que tanto la abundancia total como la riqueza fueron las mismas en cada una de las cinco comunidades. La media de cada distribución se fijó en 500 y la varianza se modificó para simular comunidades con una distribución dominante (var = 100, 250 o 1.000) o relativamente uniforme (var = 20.000 o incluso). (B a D) Resultados de la simulación que muestran cómo difería la estructura de la comunidad en las diversas comunidades iniciales para cada dilución en serie. los X El eje representa el exponente negativo del factor de dilución (por ejemplo, 4 corresponde a una dilución de 10 & # x022124), y el y El eje representa la riqueza (número de tipos o especies) (B), la uniformidad (C) o el valor calculado del índice de diversidad de Shannon-Wiener (D).

Experimentos de cultivo por lotes. (i) Configuración del microcosmos.

Las aguas residuales sin tratar se recogieron de la Instalación de Tratamiento de Aguas Residuales de la Estación Aérea de Cabo Cañaveral (Centro Espacial Kennedy, Florida) y se utilizaron como inóculo para los experimentos de microcosmos. Se recogió una sola muestra grande (2 litros) de la cubeta de equilibrado y se dejó reposar durante aproximadamente 2 h para eliminar las partículas grandes. Se prepararon diluciones seriadas diez veces (hasta 10 & # x022126) del sobrenadante en aguas residuales esterilizadas en autoclave, cada una de estas diluciones diferentes sirvió luego como inóculo para una serie de incubaciones de cultivo por lotes. Antes de la dilución, la concentración de células en el sobrenadante, determinada por recuento directo de naranja de acridina (AODC 15), fue de 1,8 & # x000d7 10 6 células / ml.

Los cultivos por lotes se establecieron añadiendo 1 ml de inóculo a 60 ml de aguas residuales esterilizadas en autoclave en un matraz Erlenmeyer de 125 ml. Se mantuvieron siete tratamientos (10 0 a 10 & # x022126) en este experimento, con tres comunidades de réplicas en cada dilución. Todos los matraces se taparon con tapones de espuma estéril para evitar la contaminación y se mantuvieron en una mesa agitadora, operada a 150 rpm, para mantener las condiciones aeróbicas. Cada día, se extrajeron 20 ml de líquido de cada matraz y se reemplazaron con 20 ml de aguas residuales estériles. Después de 9 días (tres tiempos de retención), se recolectaron y analizaron los matraces.

(ii) Recuentos culturales y diversidad de morfología de colonias.

Para cada matraz, se sembró una dilución en serie de la comunidad regenerada, por duplicado, tanto en agar R2A (35) como en medio de aguas residuales estéril (SM preparado mezclando 15 g de agar por litro de sobrenadante de aguas residuales). Las placas se incubaron a temperatura ambiente (aproximadamente 23 ° C) y se determinó el número de UFC en agar R2A después de 3 días. Se evaluó el crecimiento en SM después de 6 días.

Se comparó la diversidad de morfologías de colonias en R2A a través de los diferentes tratamientos de dilución. Para cada matraz, se seleccionaron dos placas en cada placa, se eligieron 25 colonias al azar y se describió la morfología de las colonias en función del tamaño, pigmentación, forma, elevación y superficie. Luego se calcularon la riqueza (número de morfologías de colonias distintas), la uniformidad y la diversidad (índice de diversidad de Shannon-Wiener).

(iii) CLPP.

Para cada matraz, se preparó una dilución 10 & # x022121 de la comunidad microbiana (en agua estéril) y se inoculó en microplacas Biolog GN, que luego se incubaron a temperatura ambiente (aproximadamente 23 & # x000b0C). La formación de color en cada uno de los 96 pocillos de cada placa se controló periódicamente (cada 2 a 4 h) midiendo el A590 utilizando un lector de microplacas Biotek EL 320. Los datos se normalizaron utilizando un desarrollo de color de pocillo medio corregido en blanco de 0,75 unidades de absorbancia y se analizaron utilizando un análisis de componentes principales (PCA) (8, 10).

(iv) Análisis de dilución-extinción de CLPP.

Se realizó un análisis de dilución-extinción en un subconjunto de las comunidades regeneradas (un matraz replicado de cada uno de los tratamientos de dilución 10 0, 10 & # x022122, 10 & # x022124 y 10 & # x022126) para determinar la relación entre la densidad celular (I) y riqueza funcional (número de pozos positivos, R) (9). Se inocularon diluciones en serie de las suspensiones microbianas en microplacas Biolog GN y se incubaron a temperatura ambiente durante 7 días, y A590 fue medido. Una respuesta positiva se definió como cualquier valor superior a 0,25 unidades de absorbancia (después de la corrección para el pocillo de control) y un modelo hiperbólico, R = (Rmax & # x000d7 I)/(KI & # x0002b I), dónde Rmax es igual al máximo (nivel asintótico) de R y KI es el valor de I cuando R es la mitad de Rmax, se ajustó a los datos (9).

(v) Análisis molecular del ADN de toda la comunidad. (a) Extracción y cuantificación de ADN.

En el momento de la cosecha, se recogió una muestra de aproximadamente 40 ml de cada matraz y la comunidad microbiana suspendida se concentró por centrifugación (23.000 & # x000d7 gramo, 20 minutos). El sedimento de células se resuspendió en 200 mu g de solución salina tamponada con fosfato y se almacenó a mu g de solución salina tamponada con fosfato. El ADN de toda la comunidad se extrajo usando el kit de preparación de plantillas de PCR High Pure (Boehringer Mannheim, Indianapolis, Indiana) y se cuantificó usando el reactivo de cuantificación de ADN de doble hebra PicoGreen (Molecular Probes, Eugene, OR).

(b) AFLP.

El polimorfismo de longitud de fragmento amplificado (AFLP) se completó usando el kit de huellas dactilares microbianas Perkin-Elmer (PE Applied Biosystems, Foster City, CA) siguiendo las instrucciones del fabricante para el análisis de cepas bacterianas individuales. Se utilizaron tres pares diferentes de cebadores, cada uno con un marcador fluorescente diferente, para la amplificación selectiva de AFLP: EcoRI-AA (marcado con JOE) con MseI-CA, EcoRI-AC (marcado con FAM) con MseI-CC y EcoRI-AT (NED etiquetado) con MseI-CT. Para ver las secuencias completas de cebadores y adaptadores y una explicación de los criterios de selección de cebadores utilizados, consulte la PE Applied Biosystems AFLP Protocolo de huellas dactilares microbianas (PE Applied Biosystems, Foster City, California).

Los productos de amplificación selectiva se resolvieron usando un analizador genético ABI Prism 310 siguiendo las instrucciones del fabricante con una ligera modificación para cada muestra con cada par de cebadores, se analizó 1 & # x003bcl de producto de PCR usando un tiempo de inyección de muestra de 10 s. Los datos se analizaron utilizando el software Genotyper (PE Applied Biosystems), y la presencia o ausencia de cada pico en cada muestra se codificó como 1 o 0. Se preparó una matriz de datos para cada par de cebadores y la información de los tres pares de cebadores se agrupa en un único conjunto de datos de gran tamaño. Se utilizó el coeficiente de Jaccard para determinar las distancias entre las muestras (similitud relativa) y se realizó un análisis de conglomerados (agrupamiento de grupos de pares no ponderados utilizando promedios aritméticos y vinculación entre grupos). Luego se utilizó un análisis de arranque para evaluar la importancia de cada grupo y subgrupo en el análisis de conglomerados (6).

También se realizó un PCA en la matriz de datos agrupados original (SPSS 9.0), y se hicieron gráficos de los dos primeros componentes principales (PC). Como PCA no es matemáticamente apropiado para su uso con datos binarios, su aplicación en este estudio fue únicamente para ayudar en la visualización de las relaciones entre las muestras y no para la evaluación estadística. Este enfoque se ha utilizado varias veces para comparar muestras perfiladas usando una variedad de técnicas genéticas similares (6, 7, 47, 48) PCA generalmente proporciona la misma información (agrupaciones y distancias relativas entre muestras) que el análisis de conglomerados descrito anteriormente.

(c) T-RFLP.

Cada mezcla de reacción de T-RFLP (polimorfismo de longitud de fragmento de restricción terminal) (50 & # x003bcl) contenía 25 ng de ADN comunitario Tris-Cl 10 mM (pH 8,3) KCl 50 mM MgCl 1,5 mM2 200 & # x003bcM cada dATP, dCTP, dGTP y dTTP cada cebador a una concentración de 0,1 & # x003bcM y 1,25 U de Taq ADN polimerasa (21). El gen de ARNr 16S bacteriano se amplificó usando dos cebadores: 1392 Reverse (5 & # x02032 ACGGGCGGTG TGTRC) y 27 Forward (5 & # x02032 AGAGTTTGATCCTGGCTCAG & # x0005 marcado con la etiqueta fluorescente 6-FAM & # x0005d). El programa de PCR fue 94 & # x000b0C durante 3 min, seguido de 30 ciclos de 94 & # x000b0C durante 30 s, 56 & # x000b0C durante 45 sy 72 & # x000b0C durante 2 min, con una extensión final a 72 & # x000b0C durante 3 min. Los productos de PCR se purificaron usando el sistema de purificación de ADN Wizard PCR Preps (Promega, Madison, Wis.) Y se eluyeron en un volumen final de 50 & # x003bcl. A continuación, se digirieron porciones (10 & # x003bcl) del producto de PCR purificado con el JajaYo o MspI enzima de restricción, usando el tampón de reacción recomendado por el fabricante y 20 U de enzima (New England Biolabs, Beverly, Mass.). Los digeridos se incubaron a 37ºC durante 4 h.

Las longitudes de los fragmentos de restricción terminales marcados con fluorescencia se determinaron para cada muestra usando el analizador genético ABI 310. Se mezclaron porciones de tres microlitros de cada producto digerido con 24 & # x003bcl de formamida desionizada y 1 & # x003bcl de patrón de tamaño GeneScan-1000 (PE Applied Biosystems), se desnaturalizaron a 95 & # x000b0C durante 5 min y se enfriaron rápidamente en hielo. La electroforesis se realizó utilizando las mismas condiciones que para AFLP pero con un tiempo de ejecución de 40 min. Los datos se analizaron utilizando el software GeneScan con una detección de altura de pico de 100. Al igual que con el análisis AFLP, se determinó la presencia o ausencia de cada T-RFLP en cada muestra y los datos de cada enzima de restricción se agruparon para análisis de grupos, análisis de arranque y PCA.


Cómo calcular unidades de concentración

Una vez que haya identificado el soluto y el solvente en una solución, estará listo para determinar su concentración. La concentración se puede expresar de varias formas diferentes, utilizando composición porcentual en masa, porcentaje de volumen, fracción molar, molaridad, molalidad, o normalidad.

Composición porcentual por masa (%)

Esta es la masa del soluto dividida por la masa de la solución (masa de soluto más masa de solvente), multiplicada por 100.
Ejemplo:

Determine la composición porcentual en masa de una solución salina de 100 g que contiene 20 g de sal.
Solución:

20 g de NaCl / 100 g de solución x 100 = 20% de solución de NaCl

Porcentaje de volumen (% v / v)

El porcentaje de volumen o el porcentaje de volumen / volumen se usa con mayor frecuencia cuando se preparan soluciones de líquidos. El porcentaje de volumen se define como:
v / v% = [(volumen de soluto) / (volumen de solución)] x 100%
Tenga en cuenta que el porcentaje de volumen es relativo al volumen de la solución, no al volumen de solvente. Por ejemplo, el vino tiene aproximadamente un 12% v / v de etanol. Esto significa que hay 12 ml de etanol por cada 100 ml de vino. Es importante darse cuenta de que los volúmenes de líquido y gas no son necesariamente aditivos. Si mezcla 12 ml de etanol y 100 ml de vino, obtendrá menos de 112 ml de solución.
Como otro ejemplo, se puede preparar alcohol para frotar al 70% v / v tomando 700 ml de alcohol isopropílico y agregando suficiente agua para obtener 1000 ml de solución (que no serán 300 ml).

Fracción Mole (X)

Este es el número de moles de un compuesto dividido por el número total de moles de todas las especies químicas en la solución. Tenga en cuenta que la suma de todas las fracciones molares en una solución siempre es igual a 1.
Ejemplo:
¿Cuáles son las fracciones molares de los componentes de la solución que se forman cuando se mezclan 92 g de glicerol con 90 g de agua? (peso molecular del agua = 18 peso molecular del glicerol = 92)
Solución:

90 g de agua = 90 g x 1 mol / 18 g = 5 mol de agua
92 g de glicerol = 92 g x 1 mol / 92 g = 1 mol de glicerol
mol total = 5 + 1 = 6 mol
Xagua = 5 mol / 6 mol = 0,833
X glicerol = 1 mol / 6 mol = 0,167
Es una buena idea verificar sus matemáticas asegurándose de que las fracciones molares sumen 1:
Xagua + xglicerol = .833 + 0.167 = 1.000

Molaridad (M)

La molaridad es probablemente la unidad de concentración más utilizada. Es el número de moles de soluto por litro de solución (¡no necesariamente lo mismo que el volumen de solvente!).
Ejemplo:

¿Cuál es la molaridad de una solución que se obtiene cuando se agrega agua a 11 g de CaCl?2 hacer 100 mL de solución? (El peso molecular de CaCl2 = 110)
Solución:

11 g de CaCl2 / (110 g de CaCl2 / mol CaCl2) = 0,10 mol CaCl2
100 ml x 1 l / 1000 ml = 0,10 l
molaridad = 0,10 mol / 0,10 L
molaridad = 1.0 M

Molalidad (m)

La molalidad es el número de moles de soluto por kilogramo de disolvente. Debido a que la densidad del agua a 25 ° C es de aproximadamente 1 kilogramo por litro, la molalidad es aproximadamente igual a la molaridad para soluciones acuosas diluidas a esta temperatura. Esta es una aproximación útil, pero recuerde que es solo una aproximación y no se aplica cuando la solución está a una temperatura diferente, no está diluida o usa un solvente que no sea agua.
Ejemplo:
¿Cuál es la molalidad de una solución de 10 g de NaOH en 500 g de agua? (El peso molecular de NaOH es 40)
Solución:

10 g de NaOH / (40 g de NaOH / 1 mol de NaOH) = 0,25 mol de NaOH
500 g de agua x 1 kg / 1000 g = 0,50 kg de agua
molalidad = 0,25 mol / 0,50 kg
molalidad = 0,05 M / kg
molalidad = 0,50 m

Normalidad (N)

La normalidad es igual a la gramo de peso equivalente de un soluto por litro de solución. Un gramo de peso equivalente o equivalente es una medida de la capacidad reactiva de una molécula dada. La normalidad es la única unidad de concentración que depende de la reacción.
Ejemplo:

Ácido sulfúrico 1 M (H2ASI QUE4) es 2 N para reacciones ácido-base porque cada mol de ácido sulfúrico proporciona 2 moles de iones H +. Por otro lado, el ácido sulfúrico 1 M es 1 N para la precipitación con sulfato, ya que 1 mol de ácido sulfúrico proporciona 1 mol de iones sulfato.

  1. Gramos por litro (g / L)
    Este es un método simple para preparar una solución basada en gramos de soluto por litro de solución.
  2. Formalidad (F)
    Una solución formal se expresa con respecto a las unidades de peso de la fórmula por litro de solución.
  3. Parts per Million (ppm) and Parts per Billion (ppb)Used for extremely dilute solutions, these units express the ratio of parts of solute per either 1 million parts of the solution or 1 billion parts of a solution.
    Ejemplo:

    A sample of water is found to contain 2 ppm lead. This means that for every million parts, two of them are lead. So, in a one gram sample of water, two-millionths of a gram would be lead. For aqueous solutions, the density of water is assumed to be 1.00 g/ml for these units of concentration.

MICROSOFT OFFICE 2003

  1. Once the data is highlighted, look on the upper toolbar and click on &ldquoInsert&rdquo, then on &ldquoChart&rdquo. A box with graph options will appear. Select &ldquoXY(Scatter)&rdquo and click on &ldquoNext&rdquo. (Leave the chart sub-type alone: the top chart should be highlighted.)

Your data will appear already plotted on an x-y axis system. Now you will learn how to set-up the axes, write the title of the graph and write the legend. You will also command the computer to draw best-fit lines and calculate the slope of each plot. You can also choose to make some cosmetic touches (changing the size of fonts, colors of the plot etc.&hellip) on your graph before printing.

  1. Find &ldquoSeries&rdquo towards the top of the graph and click on it. &ldquoSeries1&rdquo should appear highlighted. To the right of this there is an empty space for you to write the NAME of this plot: click on this empty box and type &ldquoAbsorbance vs. Bacterial Numbers&rdquo.
  2. Click on &ldquoNext&rdquo. Another box will appear with options to modify titles on the graph.

una. Make sure that in the window &ldquoChart Title&rdquo your graph is titled (e.g. Using Turbidemetry to Guesstimate Bacterial Numbers&rdquo).

B. Click on space below Value(X)Axis and type: Absorbance

C. Click on space below Value(Y)Axis and type: Bacterial Numbers (X 106)

D. Click on &ldquoAxes&rdquo (upper left of graph) and make sure that Value(X) Axis and Value(Y) Axis have a &radic .

e. Click on &ldquoGridlines&rdquo and add lines. Click on &ldquoMajor Gridlines&rdquo on the x-axis and y-axis.)

F. Click on &ldquoLegend&rdquo and choose the location of the legend (I chose bottom).

  1. Click on &ldquoNext&rdquo click on the button titled Place chart as object in sheet 1 (NOT as new sheet). Click on &ldquoFinish&rdquo.

Your graph will appear on the screen as shown below. You can alter its size by clicking the mouse button on the black squares around the graph and dragging the mouse with the mouse button pressed down.

  1. Now you are going to add the line that goes through the data points (trendline). Click on the graph to make sure that the black squares around the graph are there.

Move the pointer to any of the data points of a particular series (any &Delta, for example). As you do this, information about this data point will appear on the screen. Press the RIGHT mouse button. A box with choices appears. Select and click on &ldquoAdd Trendline&rdquo. Another box will appear. Select Linear (should already be highlighted). Before clicking OK, go to &ldquoOptions&rdquo on the top of the box. Click on &ldquoDisplay equation on chart&rdquo. Click on &ldquoOK&rdquo. The graph will show a best-fit line. On the graph you should see an equation which gives you the value of the slope for the line).

THE GRAPH SHOULD LOOK LIKE THE PICTURE ABOVE, BUT WITH A LINE AND THE SLOPE FORMULA.


What is CFU Calculation?

Now that you have some data, you can do the CFU calculation in the original sample.

1. Take the amount you plated (0.5 mL) and multiply by the dilution factor (0.01) to yield 0.005. You must do this to find the dilution factor which yielded your CFU count. Here, half a milliliter of the 1:100 dilution allowed you to count CFU.

2. Divide the CFU from the dilution (179) by the result from Step 1 (0.005) to yield 35,800 CFU.

This means that the original 1 mL of sample that was diluted contains 35,800 CFU. Another way to put this is to say that the original sample has 35,800 CFU/mL.

CFU is a great tool to find how many bacteria, fungi or any microorganisms there are in a given sample. The plating method described here is particularly helpful for very concentrated samples or organisms that don't grow well in liquid culture.


Ver el vídeo: Diluciones seriadas en alimentos (Enero 2022).