Información

15.2A: Transcripción en procariotas - Biología


El código genético es un conjunto de 64 codones degenerados y no superpuestos que codifica 21 aminoácidos y 3 codones de parada.

Objetivos de aprendizaje

  • Describir el código genético y cómo la secuencia de nucleótidos prescribe la secuencia de aminoácidos y de proteínas.

Puntos clave

  • La relación entre las secuencias de bases del ADN y la secuencia de aminoácidos en las proteínas se denomina código genético.
  • Hay 61 codones que codifican aminoácidos y 3 codones que codifican la terminación de la cadena para un total de 64 codones.
  • A diferencia de los eukayrotes, un cromosoma bacteriano es un círculo cerrado covalentemente.
  • La doble hélice del ADN debe desenrollarse parcialmente para que se produzca la transcripción; esta región desenrollada se llama burbuja de transcripción.

Términos clave

  • nucleótido: el monómero que comprende moléculas de ADN o ARN; Consiste en una base heterocíclica nitrogenada que puede ser una purina o pirimidina, un azúcar pentosa de cinco carbonos y un grupo fosfato.
  • aminoácidos: Cualquiera de los 20 α-aminoácidos naturales (que tienen los grupos amino y ácido carboxílico en el mismo átomo de carbono) y una variedad de cadenas laterales que se combinan, a través de enlaces peptídicos, para formar proteínas.
  • redundancia: duplicación de componentes, como codones de aminoácidos, para proporcionar la supervivencia del sistema total en caso de falla de componentes individuales

El código genético: las secuencias de nucleótidos prescriben los aminoácidos

El código genético es la relación entre las secuencias de bases del ADN y la secuencia de aminoácidos en las proteínas. Las características del código genético incluyen:

  • Los aminoácidos están codificados por tres nucleótidos.
  • No se superpone.
  • Está degenerado.

Hay 21 aminoácidos codificados genéticamente que se encuentran universalmente en la especie de los tres dominios de la vida. (Hay un aminoácido codificado genéticamente número 22, Pyl, pero hasta ahora solo se ha encontrado en un puñado de especies de Archaea y Bacteria). Sin embargo, solo hay cuatro nucleótidos diferentes en el ADN o ARN, por lo que un mínimo de tres nucleótidos son necesario para codificar cada uno de los 21 (o 22) aminoácidos. El conjunto de tres nucleótidos que codifica un solo aminoácido se conoce como codón. Hay 64 codones en total, 61 que codifican aminoácidos y 3 que codifican la terminación de la cadena. Dos de los codones para la terminación de la cadena pueden, en determinadas circunstancias, codificar aminoácidos.

La degeneración es la redundancia del código genético. El código genético tiene redundancia, pero no ambigüedad. Por ejemplo, aunque los codones GAA y GAG especifican ácido glutámico (redundancia), ninguno de ellos especifica ningún otro aminoácido (sin ambigüedad). Los codones que codifican un aminoácido pueden diferir en cualquiera de sus tres posiciones. Por ejemplo, el aminoácido ácido glutámico se especifica mediante los codones GAA y GAG (diferencia en la tercera posición); el aminoácido leucina se especifica mediante codones UUA, UUG, CUU, CUC, CUA, CUG (diferencia en la primera o tercera posición); mientras que el aminoácido serina está especificado por UCA, UCG, UCC, UCU, AGU, AGC (diferencia en la primera, segunda o tercera posición). Estas propiedades del código genético lo hacen más tolerante a fallas para mutaciones puntuales.

Origen de la transcripción en organismos procariotas.

Los procariotas son en su mayoría organismos unicelulares que, por definición, carecen de núcleos unidos a la membrana y otros orgánulos. La región central de la célula en la que reside el ADN procariótico se denomina región nucleoide. Los cromosomas bacterianos y arqueales son círculos cerrados covalentemente que no están tan compactados como los cromosomas eucariotas, pero que, no obstante, están compactados porque el diámetro de un cromosoma procariota típico es mayor que el diámetro de una célula procariota típica. Además, los procariotas a menudo tienen abundantes plásmidos, que son moléculas de ADN circulares más cortas que pueden contener solo uno o unos pocos genes y, a menudo, tienen características como la resistencia a los antibióticos.

La transcripción en procariotas (como en eucariotas) requiere que la doble hélice de ADN se desenrolle parcialmente en la región de síntesis de ARN. La región de desenrollado se llama burbuja de transcripción. La transcripción siempre procede de la misma hebra de ADN para cada gen, que se denomina hebra plantilla. El producto de ARN es complementario a la hebra molde y es casi idéntico a la otra hebra de ADN (no molde), denominada hebra codificante o codificante. La única diferencia es que en el ARN todos los nucleótidos T se reemplazan con nucleótidos U.

El nucleótido en la hebra del molde de ADN que corresponde al sitio desde el cual se transcribe el primer nucleótido de ARN 5 'se denomina nucleótido +1, o sitio de iniciación. Los nucleótidos que preceden, o 5 'hasta, el sitio de inicio de la cadena molde reciben números negativos y se designan cadena arriba. A la inversa, los nucleótidos que siguen, o en 3 'al sitio de inicio de la cadena molde se indican con una numeración "+" y se denominan nucleótidos cadena abajo.


Explicar el proceso de transcripción en procariotas.

Los procariotas tienen solo un tipo de ARN polimerasa para la transcripción de todos los tipos de genes (tanto estructurales como de ARN). Pero diferentes factores sigma pueden asociarse con la misma enzima central en diferentes momentos para la expresión de diferentes genes. En E. coli, se usa un 70 en condiciones normales 8 32/8 H bajo choque térmico, o 54 / c N bajo hambre de nitrógeno y un 28 para quimio taxis.

I. Iniciación

La transcripción se inicia mediante la unión de la holocnzima al promotor. El polipéptido o (sigma) de la holocnzima se une libremente a una secuencia del promotor incluso antes de la apertura de la doble hélice del ADN.

Así se forma un complejo binario suelto / cerrado. Después de que se forma este complejo, la secuencia adyacente del ADN se desnaturaliza formando un ojo o burbuja de transcripción. La desnaturalización facilitada ya que la región promotora es rica en AT. Esta burbuja de transcripción junto con la holoenzima unida se denomina complejo binario abierto.

El punto de inicio de la transcripción es una purina en el 90% de los casos. El primero y el segundo nucleótidos complementarios a los dos primeros nucleótidos de la hebra molde se unen en el sitio de elongación de la enzima. Se forma un enlace fosfodiéster entre estos dos ribonucleótidos mediante un ataque hidrófilo del grupo 3 & # 8242-OH del primer trifosfato de ribonucleótido en el primer enlace fosfato del segundo nucleótido, de modo que se libera un pirofosfato (P-P) en esta reacción. Ahora, el complejo consta de un ADN parcialmente desnaturalizado unido a la holoenzima que tiene un di-ribonucleótido.

Este complejo se conoce como complejo ternario. Se agregan más ribonucleótidos sin ningún movimiento de la holoenzima, de modo que se sintetiza una cadena de ARN de aproximadamente nueve nucleótidos. Durante la incorporación de los nucleótidos en la etapa inicial, existe la posibilidad de la liberación de pequeñas cadenas de ARN, proceso que se describe como iniciación abortiva.

Un ciclo de tal iniciación abortiva ocurre antes de que comience la iniciación definitiva. Una vez que la iniciación tiene éxito, el factor sigma se disocia de la ARN polimerasa, dejando la enzima central para el alargamiento de la cadena de ARN. La disociación de sigma facilita la eliminación del promotor de la enzima central para que otra holoenzima pueda unirse al promotor para que comience otra ronda de transcripción.

II. Alargamiento

El alargamiento de la cadena de ARN tiene lugar mediante la adición de ribonucleótidos al extremo 3 & # 8242 del ARN de modo que la cadena de ARN crece en la dirección 5 & # 8242-3 & # 8242.

En los procariotas, la terminación de la transcripción se produce mediante ciertas señales de terminación en el ADN llamadas terminadores (estas son secuencias de ADN). En E. coli, las señales de terminación se dividen en dos categorías, tales como:

1. Terminadores intrínsecos o factor proteico rho (r) independientes.

2. Terminador extrínseco o dependiente de rho

En la terminación intrínseca, el ARN en su extremo 3 & # 8242-cnd contiene un tramo largo de residuos U hidrógeno unido al tramo largo de residuos A de la plantilla. En el tallo del ARN, hay un tramo de segmento de alcance G-C. El segmento de alcance G-C da como resultado una formación de bucle de horquilla en el tallo de ARN. Como resultado, se libera la asociación débil entre A-U en el tramo largo de ruptura de la secuencia de terminación y el ARN.

Esto sucede porque la formación de un bucle de horquilla en el tallo del ARN antes de la señal de terminación ralentiza la transcripción y, como resultado, los enlaces dA-rU se rompen en cualquier punto liberando ARN del híbrido ARN-ADN.

En la terminación extrínseca se requiere proteína rho. Es un factor proteico importante responsable de la terminación de la transcripción de muchos genes en E. coli. Esta proteína es activa como un hexámero (que tiene seis subunidades idénticas). Tiene un peso molecular de 46.000 y también tiene actividad hidrolizante de ATP. El factor Rho se une al extremo 5 & # 8242 del m-RNA naciente y explora a lo largo de la longitud del m-RNA hasta que detecta el punto de terminación. En el punto de terminación, cuando la transcripción ralentiza, rho rompe el ATP y utiliza esa energía para desnaturalizar el híbrido ARN-ADN de modo que el ARN se libere de la burbuja.

En procariotas, como muchos genes estructurales están presentes de forma contigua y se transcriben juntos, el ARNm transcrito es policistrónico.


15.2 Transcripción procariota

Al final de esta sección, podrá hacer lo siguiente:

  • Enumere los diferentes pasos de la transcripción procariota
  • Discutir el papel de los promotores en la transcripción procariota.
  • Describir cómo y cuándo finaliza la transcripción.

Los procariotas, que incluyen bacterias y arqueas, son en su mayoría organismos unicelulares que, por definición, carecen de núcleos unidos a la membrana y otros orgánulos. Un cromosoma bacteriano es un círculo cerrado que, a diferencia de los cromosomas eucariotas, no está organizado alrededor de proteínas histonas. La región central de la célula en la que reside el ADN procariótico se denomina región nucleoide. Además, los procariotas suelen tener abundantes plásmidos, que son moléculas de ADN circulares más cortas que pueden contener solo uno o unos pocos genes. Los plásmidos se pueden transferir independientemente del cromosoma bacteriano durante la división celular y, a menudo, portan rasgos como los relacionados con la resistencia a los antibióticos.

La transcripción en procariotas (y en eucariotas) requiere que la doble hélice de ADN se desenrolle parcialmente en la región de síntesis de ARNm. La región de desenrollado se llama burbuja de transcripción. La transcripción siempre procede de la misma hebra de ADN para cada gen, que se denomina hebra plantilla. El producto de ARNm es complementario a la hebra molde y es casi idéntico a la otra hebra de ADN, denominada hebra sin plantilla o hebra codificante. La única diferencia de nucleótidos es que en el ARNm, todos los nucleótidos T se reemplazan por nucleótidos U (figura 15.7). En una doble hélice de ARN, A puede unirse a U a través de dos enlaces de hidrógeno, al igual que en el apareamiento A – T en una doble hélice de ADN.

El par de nucleótidos en la doble hélice de ADN que corresponde al sitio desde el cual se transcribe el primer nucleótido de ARNm 5 'se denomina sitio +1, o sitio de iniciación. Los nucleótidos que preceden al sitio de inicio se indican con un "-" y se designan nucleótidos aguas arriba. Por el contrario, los nucleótidos que siguen al sitio de inicio se indican con una numeración "+" y se denominan nucleótidos corriente abajo.

Inicio de la transcripción en procariotas

Los procariotas no tienen núcleos encerrados en membranas. Por lo tanto, los procesos de transcripción, traducción y degradación del ARNm pueden ocurrir todos simultáneamente. El nivel intracelular de una proteína bacteriana se puede amplificar rápidamente mediante múltiples eventos de transcripción y traducción que ocurren simultáneamente en la misma plantilla de ADN. Los genomas procarióticos son muy compactos y las transcripciones procarióticas a menudo cubren más de un gen o cistrón (una secuencia codificante de una sola proteína). Luego, los ARNm policistrónicos se traducen para producir más de un tipo de proteína.

Nuestra discusión aquí ejemplificará la transcripción al describir este proceso en Escherichia coli, una especie eubacteriana bien estudiada. Aunque existen algunas diferencias entre la transcripción en E. coli y transcripción en arqueas, una comprensión de E. coli la transcripción se puede aplicar a prácticamente todas las especies bacterianas.

ARN polimerasa procariota

Los procariotas usan la misma ARN polimerasa para transcribir todos sus genes. En E. coli, la polimerasa está compuesta por cinco subunidades polipeptídicas, dos de las cuales son idénticas. Cuatro de estas subunidades, denotadas α, α, β, y β', comprenden la enzima del núcleo de la polimerasa. Estas subunidades se ensamblan cada vez que se transcribe un gen y se desensamblan una vez que se completa la transcripción. Cada subunidad tiene un papel único que los dos α-subunidades son necesarias para ensamblar la polimerasa en el ADN β-subunidad se une al trifosfato de ribonucleósido que se convertirá en parte de la molécula de ARNm naciente y β'subunidad se une a la hebra de la plantilla de ADN. La quinta subunidad, σ, está involucrado solo en el inicio de la transcripción. Confiere especificidad transcripcional tal que la polimerasa comienza a sintetizar ARNm a partir de un sitio de iniciación apropiado. Sin σ, la enzima central se transcribiría desde sitios aleatorios y produciría moléculas de ARNm que especificaban un galimatías de proteínas. La polimerasa compuesta por las cinco subunidades se llama holoenzima.

Promotores procarióticos

Un promotor es una secuencia de ADN a la que la maquinaria de transcripción, incluida la ARN polimerasa, se une e inicia la transcripción. En la mayoría de los casos, los promotores existen corriente arriba de los genes que regulan. La secuencia específica de un promotor es muy importante porque determina si el gen correspondiente se transcribe todo el tiempo, algunas veces o con poca frecuencia. Aunque los promotores varían entre los genomas procarióticos, algunos elementos se conservan evolutivamente en muchas especies. En las regiones -10 y -35 aguas arriba del sitio de inicio, hay dos secuencias consenso del promotor, o regiones que son similares en todos los promotores y en varias especies bacterianas (Figura 15.8). La secuencia -10, llamada región -10, tiene la secuencia consenso TATAAT. La secuencia -35 tiene la secuencia consenso TTGACA. Estas secuencias de consenso son reconocidas y unidas por σ. Una vez que se realiza esta interacción, las subunidades de la enzima central se unen al sitio. La región -10 rica en A-T facilita el desenrollamiento de la plantilla de ADN y se forman varios enlaces fosfodiéster. La fase de inicio de la transcripción termina con la producción de transcripciones abortivas, que son polímeros de aproximadamente 10 nucleótidos que se producen y liberan.

Enlace al aprendizaje

Vea esta animación de MolecularMovies para ver el proceso de transcripción tal como ocurre en la célula.

Alargamiento y terminación en procariotas

La fase de elongación de la transcripción comienza con la liberación del σ subunidad de la polimerasa. La disociación de σ permite que la enzima central avance a lo largo de la plantilla de ADN, sintetizando ARNm en la dirección 5 'a 3' a una velocidad de aproximadamente 40 nucleótidos por segundo. A medida que avanza el alargamiento, el ADN se desenrolla continuamente por delante de la enzima central y se rebobina detrás de ella. El emparejamiento de bases entre el ADN y el ARN no es lo suficientemente estable como para mantener la estabilidad de los componentes de síntesis del ARNm. En cambio, la ARN polimerasa actúa como un enlazador estable entre la plantilla de ADN y las cadenas de ARN nacientes para garantizar que el alargamiento no se interrumpa prematuramente.

Señales de terminación procariotas

Una vez que se transcribe un gen, es necesario instruir a la polimerasa procariota para que se disocie de la plantilla de ADN y libere el ARNm recién creado. Dependiendo del gen que se transcribe, existen dos tipos de señales de terminación. Uno está basado en proteínas y el otro está basado en ARN. La terminación dependiente de Rho está controlada por la proteína rho, que sigue detrás de la polimerasa en la cadena de ARNm en crecimiento. Cerca del final del gen, la polimerasa encuentra una serie de nucleótidos G en la plantilla de ADN y se detiene. Como resultado, la proteína rho choca con la polimerasa. La interacción con rho libera el ARNm de la burbuja de transcripción.

La terminación independiente de Rho está controlada por secuencias específicas en la hebra molde de ADN. A medida que la polimerasa se acerca al final del gen que se transcribe, encuentra una región rica en nucleótidos C – G. El ARNm se pliega sobre sí mismo y los nucleótidos C-G complementarios se unen. El resultado es una horquilla estable que hace que la polimerasa se detenga tan pronto como comienza a transcribir una región rica en nucleótidos A – T. La región U-A complementaria del transcrito de ARNm forma solo una interacción débil con el ADN molde. Esto, junto con la polimerasa estancada, induce suficiente inestabilidad para que la enzima central se separe y libere la nueva transcripción de ARNm.

Tras la terminación, se completa el proceso de transcripción. En el momento en que se produce la terminación, la transcripción procariota ya se habría utilizado para comenzar la síntesis de numerosas copias de la proteína codificada porque estos procesos pueden ocurrir al mismo tiempo. La unificación de la transcripción, traducción e incluso la degradación del ARNm es posible porque todos estos procesos ocurren en la misma dirección 5 'a 3' y porque no hay compartimentación membranosa en la célula procariota (Figura 15.9). Por el contrario, la presencia de un núcleo en las células eucariotas impide la transcripción y traducción simultáneas.

Enlace al aprendizaje

Visite esta animación de BioStudio para ver el proceso de transcripción procariota.


Transcripción en procariotas

La transcripción en términos simples es la síntesis de ARN a partir de ADN con la ayuda de la ARN polimerasa. La transcripción procariota es menos complicada que la eucariota. A esto también contribuye el factor de que los organismos procariotas tienen una estructura bastante simple. El núcleo no está definido, carece de orgánulos unidos a la membrana y proteínas histonas. El material genético procariota contiene cromosomas bacterianos y plásmidos que llevan información genética adicional que puede ser transferida por bacterias a través de pili sexuales.

Mientras escribe un ensayo sobre la transcripción en procariotas, asegúrese de cubrir estos puntos importantes.

  • Enumere los diferentes pasos de la transcripción procariota
  • Discutir el papel del promotor
  • Describir cómo y cuándo finaliza la transcripción.

Los procariotas, incluidas las bacterias y las arqueobacterias, carecen de núcleos y orgánulos unidos a la membrana, el cromosoma bacteriano es diferente de uno eucariota, es una estructura covalentemente cerrada que carece de proteínas histonas. Transcripción que significa la síntesis de ARN a partir de una plantilla de ADN con la ayuda de la ARN polimerasa bacteriana. Aunque el procedimiento ocurre tanto en procariotas como en eucariotas, si difiere con la ARN polimerasa, los promotores y los factores de transcripción involucrados. En los procariotas, el procedimiento de transcripción implica el desenrollamiento parcial de la hélice de ADN. La región que se desenrolla forma una estructura similar a una burbuja que se conoce como burbuja de transcripción.

El par de nucleótidos en la hélice de ADN que corresponde a los primeros 5 nucleótidos de ARNm se llama sitio +1 o sitio de inicio. Los nucleótidos después del sitio de inicio se numeran con + numeración. Estos se conocen como nucleótidos corriente abajo.

credito de imagen

La transcripción implica los siguientes pasos

INICIACIÓN

En procariotas, la transcripción y la traducción ocurren simultáneamente. Antes de discutir sobre el proceso de transcripción, debemos comprender dos factores importantes que ayudan en la transcripción.

La ARN polimerasa procariota se compone de dos subunidades α, β, β ′, ω y σ. Estas subunidades juntas se conocen como holoenzima. Mientras que α, α, β, β ′, ω constituyen la enzima central.

Las subunidades α son necesarias para ensamblar la polimerasa en el ADN.

La subunidad β se une al ribonucleósido trifosfato.

La subunidad β 'se une a la plantilla de ADN.

La subunidad sigma (σ) es la más importante de todas, ya que desempeña su papel en el inicio de la transcripción. Proporciona especificidad transcripcional para que la polimerasa pueda identificar y sintetizar ARNm a partir del sitio de inicio solo si el factor sigma se une a él. Entonces, obviamente, la ausencia o el error en el factor sigma conduce a una transcripción abortada.

La ARN polimerasa no requiere un cebador.

La transcripción de procariotas está relacionada con dos promotores, uno en -10 y el otro en -35 cadena arriba del sitio de inicio. El promotor -10 corriente arriba también se conoce como caja de Pribnow (que lleva el nombre del científico). La región -10 rica en AT también facilita el desenrollamiento de la plantilla de ADN. Las regiones promotoras son reconocidas por el factor sigma y ayudan a iniciar el proceso de transcripción.

La secuencia de consenso -10 es TATAAT

La secuencia de consenso -35 es TTGACA

ALARGAMIENTO

El alargamiento de la transcripción comienza con la liberación de la subunidad sigma de la polimerasa. Esta disociación del factor sigma permite que la enzima central avance a lo largo de la plantilla de ADN sintetizando ARNm en la dirección 5 & # 8242 a 3 & # 8242 a una velocidad de 40 nucleótidos / seg.


Transcripción procariota

Los procariotas, que incluyen bacterias y arqueas, son en su mayoría organismos unicelulares que, por definición, carecen de núcleos unidos a la membrana y otros orgánulos. Un cromosoma bacteriano es un círculo cerrado covalentemente que, a diferencia de los cromosomas eucariotas, no está organizado alrededor de proteínas histonas. La región central de la célula en la que reside el ADN procariótico se llama nucleoide. Además, los procariotas suelen tener abundantes plásmidos, que son moléculas de ADN circulares más cortas que pueden contener solo uno o unos pocos genes. Los plásmidos se pueden transferir independientemente del cromosoma bacteriano durante la división celular y, a menudo, tienen características como la resistencia a los antibióticos.

La transcripción en procariotas (y en eucariotas) requiere que la doble hélice de ADN se desenrolle parcialmente en la región de síntesis de ARNm. La región de desenrollado se llama burbuja de transcripción. La transcripción siempre procede de la misma hebra de ADN para cada gen, que se denomina hebra de plantilla. El producto de ARNm es complementario a la hebra molde y es casi idéntico a la otra hebra de ADN, llamada hebra sin plantilla. La única diferencia es que en el ARNm, todos los nucleótidos T se reemplazan con nucleótidos U. En una doble hélice de ARN, A puede unirse a U a través de dos enlaces de hidrógeno, al igual que en el apareamiento A – T en una doble hélice de ADN.

El par de nucleótidos en la doble hélice de ADN que corresponde al sitio desde el cual se transcribe el primer nucleótido de ARNm 5 'se llama sitio +1, o el sitio de iniciación. Los nucleótidos que preceden al sitio de iniciación reciben números negativos y se designan río arriba. Por el contrario, los nucleótidos que siguen al sitio de inicio se indican con una numeración "+" y se denominan río abajo nucleótidos.

Inicio de la transcripción en procariotas

Los procariotas no tienen núcleos encerrados en membranas. Por lo tanto, los procesos de transcripción, traducción y degradación del ARNm pueden ocurrir todos simultáneamente. El nivel intracelular de una proteína bacteriana puede amplificarse rápidamente mediante múltiples eventos de transcripción y traducción que ocurren simultáneamente en la misma plantilla de ADN. La transcripción procariota a menudo cubre más de un gen y produce ARNm policistrónicos que especifican más de una proteína.

Nuestra discusión aquí ejemplificará la transcripción al describir este proceso en Escherichia coli, una especie bacteriana bien estudiada. Aunque existen algunas diferencias entre la transcripción en E. coli y transcripción en arqueas, una comprensión de E. coli la transcripción se puede aplicar a prácticamente todas las especies bacterianas.

ARN polimerasa procariota

Los procariotas usan la misma ARN polimerasa para transcribir todos sus genes. En E. coli, la polimerasa está compuesta por cinco subunidades polipeptídicas, dos de las cuales son idénticas. Cuatro de estas subunidades, denotadas α, α, β, y β'comprenden la polimerasa enzima central. Estas subunidades se ensamblan cada vez que se transcribe un gen y se desensamblan una vez que se completa la transcripción. Cada subunidad tiene un papel único que los dos α-subunidades son necesarias para ensamblar la polimerasa en el ADN β-subunidad se une al trifosfato de ribonucleósido que se convertirá en parte de la molécula de ARNm naciente "recién nacida" y β'se une a la hebra de la plantilla de ADN. La quinta subunidad, σ, está involucrado solo en el inicio de la transcripción. Confiere especificidad transcripcional tal que la polimerasa comienza a sintetizar ARNm a partir de un sitio de iniciación apropiado. Sin σ, la enzima central se transcribiría desde sitios aleatorios y produciría moléculas de ARNm que especificaban un galimatías de proteínas. La polimerasa compuesta por las cinco subunidades se llama holoenzima.

Promotores procarióticos

A promotor es una secuencia de ADN a la que se une la maquinaria de transcripción e inicia la transcripción. En la mayoría de los casos, los promotores existen corriente arriba de los genes que regulan. La secuencia específica de un promotor es muy importante porque determina si el gen correspondiente se transcribe todo el tiempo, algunas veces o con poca frecuencia. Aunque los promotores varían entre los genomas procarióticos, se conservan algunos elementos. En las regiones -10 y -35 corriente arriba del sitio de inicio, hay dos promotores consenso secuencias o regiones que son similares en todos los promotores y en varias especies bacterianas ([enlace]). La secuencia de consenso -10, llamada región -10, es TATAAT. La secuencia -35, TTGACA, es reconocida y unida por σ. Una vez que se realiza esta interacción, las subunidades de la enzima central se unen al sitio. La región -10 rica en A-T facilita el desenrollamiento de la plantilla de ADN y se forman varios enlaces fosfodiéster. La fase de inicio de la transcripción termina con la producción de transcripciones abortivas, que son polímeros de aproximadamente 10 nucleótidos que se producen y liberan.

Vea esta animación de MolecularMovies para ver la primera parte de la transcripción y la repetición de la secuencia base del cuadro TATA.

Alargamiento y terminación en procariotas

La fase de elongación de la transcripción comienza con la liberación del σ subunidad de la polimerasa. La disociación de σ permite que la enzima central avance a lo largo de la plantilla de ADN, sintetizando ARNm en la dirección 5 'a 3' a una velocidad de aproximadamente 40 nucleótidos por segundo. A medida que avanza el alargamiento, el ADN se desenrolla continuamente por delante de la enzima central y se rebobina detrás de ella ([enlace]). El emparejamiento de bases entre el ADN y el ARN no es lo suficientemente estable como para mantener la estabilidad de los componentes de síntesis del ARNm. En cambio, la ARN polimerasa actúa como un enlazador estable entre la plantilla de ADN y las cadenas de ARN nacientes para garantizar que el alargamiento no se interrumpa prematuramente.

Señales de terminación procariotas

Una vez que se transcribe un gen, es necesario instruir a la polimerasa procariota para que se disocie de la plantilla de ADN y libere el ARNm recién creado. Dependiendo del gen que se transcribe, existen dos tipos de señales de terminación. Uno está basado en proteínas y el otro está basado en ARN. Terminación dependiente de Rho está controlado por la proteína rho, que sigue detrás de la polimerasa en la cadena de ARNm en crecimiento. Cerca del final del gen, la polimerasa encuentra una serie de nucleótidos G en la plantilla de ADN y se detiene. Como resultado, la proteína rho choca con la polimerasa. La interacción con rho libera el ARNm de la burbuja de transcripción.

Terminación independiente de Rho está controlado por secuencias específicas en la hebra de la plantilla de ADN. A medida que la polimerasa se acerca al final del gen que se transcribe, encuentra una región rica en nucleótidos C – G. El ARNm se pliega sobre sí mismo y los nucleótidos C-G complementarios se unen. El resultado es un estable horquilla que hace que la polimerasa se detenga tan pronto como comienza a transcribir una región rica en nucleótidos A – T. La región U-A complementaria del transcrito de ARNm forma solo una interacción débil con el ADN molde. Esto, junto con la polimerasa estancada, induce suficiente inestabilidad para que la enzima central se separe y libere la nueva transcripción de ARNm.

Tras la terminación, se completa el proceso de transcripción. En el momento en que se produce la terminación, la transcripción procariota ya se habría utilizado para comenzar la síntesis de numerosas copias de la proteína codificada porque estos procesos pueden ocurrir al mismo tiempo. La unificación de la transcripción, traducción e incluso la degradación del ARNm es posible porque todos estos procesos ocurren en la misma dirección 5 'a 3' y porque no hay compartimentación membranosa en la célula procariota ([enlace]). Por el contrario, la presencia de un núcleo en las células eucariotas impide la transcripción y traducción simultáneas.

Visite esta animación de BioStudio para ver el proceso de transcripción procariota.

Resumen de la sección

En procariotas, la síntesis de ARNm se inicia en una secuencia promotora en la plantilla de ADN que comprende dos secuencias consenso que reclutan ARN polimerasa. La polimerasa procariota consta de una enzima central de cuatro subunidades proteicas y una σ proteína que ayuda solo con la iniciación. El alargamiento sintetiza ARNm en la dirección 5 'a 3' a una velocidad de 40 nucleótidos por segundo. La terminación libera el ARNm y se produce por interacción de la proteína rho o por la formación de una horquilla de ARNm.

Preguntas de revisión

¿Qué subunidad del E. coli ¿La polimerasa confiere especificidad a la transcripción?

Las regiones -10 y -35 de los promotores procarióticos se denominan secuencias consenso porque ________.

  1. son idénticos en todas las especies bacterianas
  2. son similares en todas las especies bacterianas
  3. existen en todos los organismos
  4. tienen la misma función en todos los organismos

Respuesta libre

Si el ARNm es complementario a la hebra de la plantilla de ADN y la hebra de la plantilla de ADN es complementaria a la hebra de ADN sin plantilla, entonces ¿por qué las secuencias de bases del ARNm y la hebra de ADN sin plantilla no son idénticas? ¿Podrían serlo alguna vez?

El ADN es diferente del ARN en que los nucleótidos T en el ADN se reemplazan por nucleótidos U en el ARN. Por lo tanto, nunca podrían ser idénticos en secuencia de bases.

En sus propias palabras, describa la diferencia entre la terminación de la transcripción rho-dependiente y la rho-independiente en procariotas.

La terminación dependiente de Rho está controlada por la proteína rho, que sigue detrás de la polimerasa en la cadena de ARNm en crecimiento. Cerca del final del gen, la polimerasa se detiene en una serie de nucleótidos G en la plantilla de ADN. La proteína rho choca con la polimerasa y libera ARNm de la burbuja de transcripción. La terminación independiente de Rho está controlada por secuencias específicas en la hebra molde de ADN. A medida que la polimerasa se acerca al final del gen que se transcribe, encuentra una región rica en nucleótidos C – G. Esto crea una horquilla de ARNm que hace que la polimerasa se detenga justo cuando comienza a transcribir una región rica en nucleótidos A – T. Debido a que los enlaces A – U son menos termoestables, la enzima central desaparece.

Glosario


TRANSCRIPCIÓN Diferencia entre procariotas y eucariotas

Este es un proceso en el que la información de una cadena de ADN se copia en ARN mensajero (m-ARN). Describe cómo una hebra de ADN se convierte en ARN (m-ARN). Este es un proceso del dogma central. Para comprender la diferencia entre la transcripción procariota y eucariota, primero debemos saber qué es la transcripción y cómo funciona el proceso. Puede encontrar el resumen de la transcripción en la página (Ir a la página)….

¿POR QUÉ EL PROCESO DE TRANSCRIPCIÓN ES MÁS COMPLICADO EN EUKARYOTES QUE EN PROKARYOTES?

A continuación se enumeran algunas razones por las que podemos diferenciar la transcripción procariota y eucariota:

  • En eucariotas, la envoltura nuclear está bien desarrollada debido a que el ARN debe llegar al citoplasma a través de nucleoporos para formar proteínas.
  • Otra complejidad es la presencia de tres tipos de ARN.
  • * m-ARN (catalizado por ARN polimerasa 2)
  • * t-ARN (catalizado por ARN polimerasa3)
  • * ARNr (catalizado por ARN polimerasa 1)
  • La conversión de Hn-ARN en ARN mensajero maduro mediante el proceso de empalme, taponamiento y colas es otra tarea que debe realizarse dentro de los eucariotas.
  • [Hn-ARN es ARN nuclear heterogéneo].
  • Cuando los procariotas contienen solo 3 promotores diferentes: promotor -10, -35 y elementos cadena arriba, los eucariotas contienen diferentes promotores: elementos iniciadores, caja TATA, caja CAAT, elementos promotores.
  • En procariotas, el proceso de transcripción y traducción ocurre simultáneamente. En eucariotas 1º, el ARN se transcribe en el núcleo y se traduce en el citoplasma (después de la transcripción).
  • Terminación en procariotas realizada por un rho-independiente o rho-proceso dependiente. Mientras que en los procariotas la terminación se produce mediante la señal de la cola de Poly A y la secuencia del terminador aguas abajo.

Procariotas vs Eucariotas (Traducción)

S.NO Procariotas Eucariotas
1 Es necesario formular metionina (el aminoácido iniciador) (debido a la existencia de dos ARNt para la metionina). La metionina no está formulada porque solo hay un ARNt presente para la metionina.
2. En procariotas, los ribosomas llegan al ARNm en AGO codón o sitio cercano de Shine-Dalgarno. Los ribosomas llegan al extremo 5 'del ARNm.
3. No se necesitan factores de iniciación para crear un contacto inicial entre los ribosomas y el ARNm Se necesitan muchos factores proteicos junto con ATP para activar el ARNm para los ribosomas.
4. Las unidades pequeñas (los 30) del ribosoma también pueden comprometer el ARNm antes de unirse al iniciador metionina Pequeñas unidades (los 40) de ribosomas se unen al ARNm después de que la metionina iniciadora se une al ARNt.

El proceso de empalme, tapado y cola es otro proceso que se discutirá más adelante.


74 Transcripción procariota

Al final de esta sección, podrá hacer lo siguiente:

  • Enumere los diferentes pasos de la transcripción procariota
  • Discutir el papel de los promotores en la transcripción procariota.
  • Describir cómo y cuándo finaliza la transcripción.

Los procariotas, que incluyen bacterias y arqueas, son en su mayoría organismos unicelulares que, por definición, carecen de núcleos unidos a la membrana y otros orgánulos. Un cromosoma bacteriano es un círculo cerrado que, a diferencia de los cromosomas eucariotas, no está organizado alrededor de proteínas histonas. La región central de la célula en la que reside el ADN procariótico se denomina región nucleoide. Además, los procariotas suelen tener abundantes plásmidos, que son moléculas de ADN circulares más cortas que pueden contener solo uno o unos pocos genes. Los plásmidos se pueden transferir independientemente del cromosoma bacteriano durante la división celular y, a menudo, portan rasgos como los relacionados con la resistencia a los antibióticos.

La transcripción en procariotas (y en eucariotas) requiere que la doble hélice de ADN se desenrolle parcialmente en la región de síntesis de ARNm. La región de desenrollado se llama burbuja de transcripción. La transcripción siempre procede de la misma hebra de ADN para cada gen, que se denomina hebra plantilla. El producto de ARNm es complementario a la hebra molde y es casi idéntico a la otra hebra de ADN, denominada hebra sin plantilla o hebra codificante. La única diferencia de nucleótidos es que en el ARNm, todos los nucleótidos T se reemplazan con nucleótidos U ((Figura)). En una doble hélice de ARN, A puede unirse a U a través de dos enlaces de hidrógeno, al igual que en el apareamiento A – T en una doble hélice de ADN.


El par de nucleótidos en la doble hélice de ADN que corresponde al sitio desde el cual se transcribe el primer nucleótido de ARNm 5 & # 8242 se denomina sitio +1, o sitio de iniciación. Los nucleótidos que preceden al sitio de inicio se indican con un "-" y se designan nucleótidos aguas arriba. Por el contrario, los nucleótidos que siguen al sitio de inicio se indican con una numeración "+" y se denominan nucleótidos corriente abajo.

Inicio de la transcripción en procariotas

Los procariotas no tienen núcleos encerrados en membranas. Por lo tanto, los procesos de transcripción, traducción y degradación del ARNm pueden ocurrir todos simultáneamente. El nivel intracelular de una proteína bacteriana se puede amplificar rápidamente mediante múltiples eventos de transcripción y traducción que ocurren simultáneamente en la misma plantilla de ADN. Los genomas procarióticos son muy compactos y las transcripciones procarióticas a menudo cubren más de un gen o cistrón (una secuencia codificante de una sola proteína). Luego, los ARNm policistrónicos se traducen para producir más de un tipo de proteína.

Nuestra discusión aquí ejemplificará la transcripción al describir este proceso en Escherichia coli, una especie eubacteriana bien estudiada. Aunque existen algunas diferencias entre la transcripción en E. coli y transcripción en arqueas, una comprensión de E. coli la transcripción se puede aplicar a prácticamente todas las especies bacterianas.

ARN polimerasa procariota

Los procariotas usan la misma ARN polimerasa para transcribir todos sus genes. En E. coli, la polimerasa está compuesta por cinco subunidades polipeptídicas, dos de las cuales son idénticas. Cuatro de estas subunidades, denotadas α, α, β, y β& # 8216, comprenden la enzima del núcleo de la polimerasa. Estas subunidades se ensamblan cada vez que se transcribe un gen y se desensamblan una vez que se completa la transcripción. Cada subunidad tiene un papel único que los dos α-subunidades son necesarias para ensamblar la polimerasa en el ADN β-subunidad se une al trifosfato de ribonucleósido que se convertirá en parte de la molécula de ARNm naciente y β& # 8216 subunidad se une a la hebra de plantilla de ADN. La quinta subunidad, σ, está involucrado solo en el inicio de la transcripción. Confiere especificidad transcripcional tal que la polimerasa comienza a sintetizar ARNm a partir de un sitio de iniciación apropiado. Sin σ, la enzima central se transcribiría desde sitios aleatorios y produciría moléculas de ARNm que especificaban un galimatías de proteínas. La polimerasa compuesta por las cinco subunidades se llama holoenzima.

Promotores procarióticos

Un promotor es una secuencia de ADN a la que la maquinaria de transcripción, incluida la ARN polimerasa, se une e inicia la transcripción. En la mayoría de los casos, los promotores existen corriente arriba de los genes que regulan. La secuencia específica de un promotor es muy importante porque determina si el gen correspondiente se transcribe todo el tiempo, algunas veces o con poca frecuencia. Aunque los promotores varían entre los genomas procarióticos, algunos elementos se conservan evolutivamente en muchas especies. En las regiones -10 y -35 aguas arriba del sitio de inicio, hay dos secuencias consenso del promotor, o regiones que son similares en todos los promotores y en varias especies bacterianas ((Figura)). La secuencia -10, llamada región -10, tiene la secuencia consenso TATAAT. La secuencia -35 tiene la secuencia consenso TTGACA. Estas secuencias de consenso son reconocidas y unidas por σ. Una vez que se realiza esta interacción, las subunidades de la enzima central se unen al sitio. La región -10 rica en A-T facilita el desenrollamiento de la plantilla de ADN y se forman varios enlaces fosfodiéster. La fase de inicio de la transcripción termina con la producción de transcripciones abortivas, que son polímeros de aproximadamente 10 nucleótidos que se producen y liberan.


Vea esta animación de MolecularMovies para ver la primera parte de la transcripción y la repetición de la secuencia base del cuadro TATA.

Alargamiento y terminación en procariotas

La fase de elongación de la transcripción comienza con la liberación del σ subunidad de la polimerasa. La disociación de σ permite que la enzima central avance a lo largo de la plantilla de ADN, sintetizando ARNm en la dirección 5 & # 8242 a 3 & # 8242 a una velocidad de aproximadamente 40 nucleótidos por segundo. A medida que avanza el alargamiento, el ADN se desenrolla continuamente por delante de la enzima central y se rebobina detrás de ella. El emparejamiento de bases entre el ADN y el ARN no es lo suficientemente estable como para mantener la estabilidad de los componentes de síntesis del ARNm. En cambio, la ARN polimerasa actúa como un enlazador estable entre la plantilla de ADN y las cadenas de ARN nacientes para garantizar que el alargamiento no se interrumpa prematuramente.

Señales de terminación procariotas

Una vez que se transcribe un gen, es necesario instruir a la polimerasa procariota para que se disocie de la plantilla de ADN y libere el ARNm recién creado. Dependiendo del gen que se transcribe, existen dos tipos de señales de terminación. Uno está basado en proteínas y el otro está basado en ARN. La terminación dependiente de Rho está controlada por la proteína rho, que sigue detrás de la polimerasa en la cadena de ARNm en crecimiento. Cerca del final del gen, la polimerasa encuentra una serie de nucleótidos G en la plantilla de ADN y se detiene. Como resultado, la proteína rho choca con la polimerasa. La interacción con rho libera el ARNm de la burbuja de transcripción.

La terminación independiente de Rho está controlada por secuencias específicas en la hebra molde de ADN. A medida que la polimerasa se acerca al final del gen que se transcribe, encuentra una región rica en nucleótidos C – G. El ARNm se pliega sobre sí mismo y los nucleótidos C-G complementarios se unen. El resultado es una horquilla estable que hace que la polimerasa se detenga tan pronto como comienza a transcribir una región rica en nucleótidos A – T. La región U-A complementaria del transcrito de ARNm forma solo una interacción débil con el ADN molde. Esto, junto con la polimerasa estancada, induce suficiente inestabilidad para que la enzima central se separe y libere la nueva transcripción de ARNm.

Tras la terminación, se completa el proceso de transcripción. En el momento en que se produce la terminación, la transcripción procariota ya se habría utilizado para comenzar la síntesis de numerosas copias de la proteína codificada porque estos procesos pueden ocurrir al mismo tiempo. La unificación de la transcripción, traducción e incluso la degradación del ARNm es posible porque todos estos procesos ocurren en la misma dirección 5 & # 8242 a 3 & # 8242, y porque no hay compartimentación membranosa en la célula procariota ((Figura)). Por el contrario, la presencia de un núcleo en las células eucariotas impide la transcripción y traducción simultáneas.


Visite esta animación de BioStudio para ver el proceso de transcripción procariota.

Resumen de la sección

En procariotas, la síntesis de ARNm se inicia en una secuencia promotora en la plantilla de ADN que comprende dos secuencias consenso que reclutan ARN polimerasa. La polimerasa procariota consta de una enzima central de cuatro subunidades proteicas y una σ proteína que ayuda solo con la iniciación. El alargamiento sintetiza ARNm en la dirección 5 & # 8242 a 3 & # 8242 a una velocidad de 40 nucleótidos por segundo. La terminación libera el ARNm y se produce por interacción de la proteína rho o por la formación de una horquilla de ARNm.

Preguntas de revisión

¿Qué subunidad del E. coli ¿La polimerasa confiere especificidad a la transcripción?

Las regiones -10 y -35 de los promotores procarióticos se denominan secuencias consenso porque ________.

  1. son idénticos en todas las especies bacterianas
  2. son similares en todas las especies bacterianas
  3. existen en todos los organismos
  4. tienen la misma función en todos los organismos

Tres especies de bacterias diferentes tienen las siguientes secuencias consenso cadena arriba de un gen conservado.

Especie A Especie B Especie C
-10 TAATAAT TTTAAT TATATT
-35 TTGACA TTGGCC TTGAAA

Ordene las bacterias desde el inicio de la transcripción de genes de mayor a menor eficacia.

Preguntas de pensamiento crítico

Si el ARNm es complementario a la hebra de la plantilla de ADN y la hebra de la plantilla de ADN es complementaria a la hebra de ADN sin plantilla, entonces ¿por qué las secuencias de bases del ARNm y la hebra de ADN sin plantilla no son idénticas? ¿Podrían serlo alguna vez?

El ADN es diferente del ARN en que los nucleótidos T en el ADN se reemplazan por nucleótidos U en el ARN. Por lo tanto, nunca podrían ser idénticos en secuencia de bases.

En sus propias palabras, describa la diferencia entre la terminación de la transcripción rho-dependiente y la rho-independiente en procariotas.

La terminación dependiente de Rho está controlada por la proteína rho, que sigue detrás de la polimerasa en la cadena de ARNm en crecimiento. Cerca del final del gen, la polimerasa se detiene en una serie de nucleótidos G en la plantilla de ADN. La proteína rho choca con la polimerasa y libera ARNm de la burbuja de transcripción. La terminación independiente de Rho está controlada por secuencias específicas en la hebra molde de ADN. A medida que la polimerasa se acerca al final del gen que se transcribe, encuentra una región rica en nucleótidos C – G. Esto crea una horquilla de ARNm que hace que la polimerasa se detenga justo cuando comienza a transcribir una región rica en nucleótidos A – T. Debido a que los enlaces A – U son menos termoestables, la enzima central desaparece.

Un fragmento de ADN bacteriano dice:

3 ’–TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5’

Suponiendo que este fragmento es la hebra molde, ¿cuál es la secuencia de ARNm que se transcribiría? (Sugerencia: asegúrese de identificar el sitio de inicio).

Al examinar la secuencia de ADN, podemos ver que hay una secuencia de consenso -10 cerca del extremo 3 'del fragmento. Si luego contamos aguas abajo, el sitio de iniciación +1 es la T que sigue inmediatamente a la secuencia AAT. Esto significa que el fragmento de ADN que servirá como molde para la transcripción tiene la secuencia TGATAGAAGCACTCTAC. El ARNm elaborado a partir de esta plantilla tendrá un emparejamiento de bases complementario con uracilo (U) en lugar de timina (T). Esto nos da ACUAUCUUCGUGAGAUG como la secuencia de ARNm transcrita.

Glosario


Transcripción en procariotas

Este completo conjunto de animaciones incluye todas las etapas de la transcripción en la iniciación, elongación y terminación de los procariotas. Se enfatiza la relación estructura-función y las interacciones proteína-proteína / proteína-ácido nucleico. Todas las estructuras de proteínas y ácidos nucleicos se presentan a escala, y todas las interacciones proteína / ácido nucleico y los cambios conformacionales se representan con precisión, según las últimas investigaciones científicas. El video de iniciación / elongación comienza con una introducción a la ARN polimerasa y el factor sigma. La unión de sigma al promotor se muestra con precisión, lo que permite a los estudiantes comprender la relación estructura-función entre el promotor y la holoenzima.

El video continúa con una visualización de cómo el factor sigma carga físicamente el ADN en la ARN polimerasa, lo que finalmente conduce al complejo abierto. Luego, los estudiantes ven cómo sigma bloquea inicialmente el canal de salida, lo que les permite comprender el mecanismo detrás de las transcripciones abortadas. El video de terminación cubre tanto la terminación intrínseca como la dependiente de Rho, y se centra en cómo los cambios conformacionales impulsados ​​por ATP dentro de las subunidades Rho conducen a la translocación de la proteína hacia arriba del ARNm.


Inicio de la transcripción en procariotas

Los procariotas no tienen núcleos encerrados en membranas. Por lo tanto, los procesos de transcripción, traducción y degradación del ARNm pueden ocurrir todos simultáneamente. El nivel intracelular de una proteína bacteriana puede amplificarse rápidamente mediante múltiples eventos de transcripción y traducción que ocurren simultáneamente en la misma plantilla de ADN. La transcripción procariota a menudo cubre más de un gen y produce ARNm policistrónicos que especifican más de una proteína.

Nuestra discusión aquí ejemplificará la transcripción al describir este proceso en Escherichia coli, una especie bacteriana bien estudiada. Aunque existen algunas diferencias entre la transcripción en E. coli y transcripción en arqueas, una comprensión de E. coli la transcripción se puede aplicar a prácticamente todas las especies bacterianas.


En procariotas, la síntesis de ARNm se inicia en una secuencia promotora en la plantilla de ADN que comprende dos secuencias consenso que reclutan ARN polimerasa. La polimerasa procariota consta de una enzima central de cuatro subunidades proteicas y una σ proteína que ayuda solo con la iniciación. El alargamiento sintetiza ARNm en la dirección 5 'a 3' a una velocidad de 40 nucleótidos por segundo. La terminación libera el ARNm y se produce por interacción de la proteína rho o por la formación de una horquilla de ARNm.

¿Qué subunidad del E. coli ¿La polimerasa confiere especificidad a la transcripción?